Vicky G.

Fall 2013

WEEK 11 & 12 (11/18--12/1)-

Enzyme Inhibition Assay: Sample A, Trial 1 (11/26/13)

Spectrometer graph result of absorbance vs. time of Trial 1 of inhibition assays of Tb6pgdh (Sample A, 20% glycerol). The reaction was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 95uL Nanopure water, 10uL 100mM MgCl2, and 10uL Tb6pgdh (B/C, 20% glycerol). 10uL of 10mM inhibitor 9038774 (made from 6uL DMSO) was added, and the solution was allowed to incubate for 3 minutes, after which 20 ul of 1mM NADP+ was added. 10ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.8 minutes. The sharp peak indicates the addition of 6-PG to solution, and the second peak at approximately 9.1 minutes indicates insertion of pipette to mix the solution.



Analysis: The graph shows a rise in absorbance at 340nm after the addition of 6-PG. This implies that NADP+ is being reduced to NADPH. The slope of the graph appears to be fairly flat, indicating a slower reaction. The slope of this graph must be compared to the slope of reproducible activity assays of Sample A of Tb6pgdh (not available at this time). If the slope in less steep in this graph, then the enzyme is being inhibited. However, it would not be known if it is inhibited by the compound or by DMSO.

Reproducible results from activity assays of Sample A must first be accomplished. Then the absorbance level of DMSO will be measured using a spectra graph, to ensure that it does not absorb at 340nm. An assay with the enzyme and DMSO (but not an inhibitor) will be conducted to determine if DMSO actually inhibits the protein. Finally, inhibition assays will be performed until repeatable data is produced indicating sufficient inhibition of the protein by a compound.

Enzyme Inhibition Assay: Sample B/C, Trial 4 and Activity Assay Trial 19 (11/26/13)

Spectrometer graph result of absorbance vs. time of Trial 4 of inhibition assays of Tb6pgdh (Sample B/C, 20% glycerol) and Trial 19 of activity assays of Tb6pgdh (Sample B/C, 20% glycerol). Both reactions were measured at 340nm in a round-top cuvette.



Red graph: Trial 4 of inhibition assays of Sample B of Tb6pgdh. The solution contained 250uL of 100mM HEPES buffer, 95uL Nanopure water, 10uL 100mM MgCl2, and 10uL Tb6pgdh (B/C, 20% glycerol). 10uL of 10mM inhibitor 9038774 (made 6uL DMSO) was added, and the solution was allowed to incubate for 3 minutes, after which 20 ul of 1mM NADP+ was added. 10ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 0.4 minutes). The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).



Blue graph: Spectrometer graph results of absorbance vs. time of activity assay of Tb6pgdh (Sample B/C) at 340nm. Solution contained 250uL of 100mM HEPES buffer, 100uL Nanopure water, 10uL of 100mM MgCl2, 10uL of Tb6pgdh protein (B/C sample, in 20% glycerol), and 20 ul of 1mM NADP+. 10ul of 1mM 6-PG in 100uL Nanopure water was added forcefully at approximately 1.2 minutes.



Analysis: The red graph shows a dramatic spike in absorbance at 340nm. This implies that NADPH is present in solution, indicating that the inhibitor did not work. Because the graph was so odd, with an extremely steep slope and a very shaky plateau, an activity assay was run to determine if the enzyme was still functioning correctly. This is represented by the blue graph. The slope of the graph is unclear, and the graph shows an immediate plateau indicating complete NADP+ reduction after the addition of 6-PG. This could indicate that the enzyme is no longer functioning correctly, or perhaps a grave error was occurred in pipetting technique. An inhibition trial of Sample A of Tb6pgdh will be conducted.

Enzyme Inhibition Assay: Sample B/C, Trial 5--11 (11/26/13)

Spectrometer graph result of absorbance vs. time of Trials 1-3 of inhibition assays of Tb6pgdh (Sample B/C, 20% glycerol). The reaction was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 95uL Nanopure water, 10uL 100mM MgCl2, and 10uL Tb6pgdh (B/C, 20% glycerol). 5uL of 10mM inhibitor 9038774 (made 6uL DMSO) was added, and the solution was allowed to incubate for 3 minutes, after which 20 ul of 1mM NADP+ was added. 10ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 2 minutes for Trials 1(red graph) and 2 (blue graph), and 1 minute for Trial 3 (green graph). The sharp peaks indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is unclear, and the graph shows an immediate plateau indicating complete NADP+ reduction after each addition of 6-PG. This could indicate a non-inhibiting compound, too low of a concentration of the inhibitor, or an error with the enzyme or substrates. Another trial will be run using a higher concentration of inhibitor.

Enzyme Activity Assay: Sample B/C, Trial 19--22 (11/26/13)

Spectrometer graph results of absorbance vs. time of activity assays of Tb6pgdh (Sample B/C) at 340nm. All solutions contained 250uL of 100mM HEPES buffer, 100uL Nanopure water, 10uL of 100mM MgCl2, 10uL of Tb6pgdh protein (B/C sample, in 20% glycerol), and 20 ul of 1mM NADP+. 10ul of 1mM 6-PG in 100uL Nanopure water was added forcefully at approximately 1.5 minutes. Trial 19 is represented by the red graph, Trial 20 by the blue, Trial 21 by the green, and Trial 22 by the orange graph.

Analysis: All trials appear to be converting NADP+ into NADPH, which is absorbed at 340nm. The slopes of the reactions are all the same, and good, indicating a slow production of NADPH over approximately 2 minutes. This sample (B/C stored in 20% glycerol) will be used in inhibition assays.

Awesome work--nice asssays. -UM

Enzyme Activity Assay: Sample B/C, Trial 12--18 (11/25/13)

Spectrometer graph result of absorbance vs. time of Trial 12 of activity assays of Tb6pgdh (Sample B/C). The reaction was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 107.5uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 7.5uL Tb6pgdh (B/C, -80°C). 5ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 2.5 minutes (on the graph). The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is unclear, and the graph shows an immediate plateau indicating complete NADP+ reduction after each addition of 6-PG. This could have been due to the 6-PG being added roughly 10 minutes after all of the other reagents—a new spectrometer was set up, calibrated to a different empty round top cuvette, and used after the spectrometer initially used did not function.

Spectrometer graph result of absorbance vs. time of Trial 13 of activity assays of Tb6pgdh (Sample B/C). The reaction was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 107.5uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 7.5uL Tb6pgdh (B/C, -80°C). 5ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is unclear, and the graph shows an immediate plateau indicating complete NADP+ reduction after each addition of 6-PG. This could have been due to too low a concentration of enzyme. Another trial will be performed with more of the enzyme in an attempt to achieve a graph that reflects a correctly and ideally functioning protein.



Spectrometer graph result of absorbance vs. time of Trial 14 of activity assays of Tb6pgdh (Sample B/C). The reaction was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 105uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh (B/C, -80°C). 5ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.3 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).



Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is solid, and the graph shows a plateau indicating complete NADP+ reduction. The reaction is happening too quickly, though. Another trial will be performed with enzyme sample stored in 20% glycerol and new substrate dilutions.





Spectrometer graph results of absorbance vs. time of activity assays of Tb6pgdh (Sample B/C) at 340nm. All solutions contained 250uL of 100mM HEPES buffer, 10uL of 100mM MgCl2, and 20 ul of 1mM NADP+.

Red graph: Trial 15 was completed in a round top cuvette; solution contained 105uL Nanopure water and 10uL of Tb6pgdh protein (B/C sample, in 20% glycerol). 5ul of 1mM 6-PG in 100uL Nanopure water was added forcefully at approximately 2 minutes.

Blue graph: Trial 16 was completed in a round top cuvette; solution contained 100uL Nanopure water and 10uL of Tb6pgdh protein (B/C sample, in 20% glycerol). 10ul of 1mM 6-PG in 100uL Nanopure water was added forcefully at approximately 4.5 minutes.

Green graph: Trial 17 was completed in a round top cuvette; solution contained 105uL Nanopure water and 5uL of Tb6pgdh protein (B/C sample, in 20% glycerol). 10ul of 1mM 6-PG in 100uL Nanopure water was added forcefully at approximately 4.5 minutes.

Orange graph: Trial 18 was completed in a round top cuvette; solution contained 105uL Nanopure water and 5uL of Tb6pgdh protein (B/C sample, in 20% glycerol). 10ul of 1mM 6-PG in 100uL Nanopure water was added forcefully at approximately 2 minutes.


Analysis: All trials appear to be converting NADP+ into NADPH, which is absorbed at 340nm. Trial 16 seems to have worked well, although the slope of the reaction could be lower for an ideal activity assay (a slow increase in NADPH production of two minutes is desired). The next step will be to attempt to replicate this trial for n=3 times in order to move on to inhibition assays with confidence.

Enzyme Activity Assay: Sample B/C, Trial 5--11 (11/21/13)

Spectrometer graph result of absorbance vs. time of Trial 5 of activity assays of Tb6pgdh (Sample B/C). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 107uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 3ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is unclear, and the graph shows an immediate plateau indicating complete NADP+ reduction after each addition of 6-PG. This could have been due to too low a concentration of enzyme. Another trial will be performed with more of the enzyme in an attempt to achieve a graph that reflects a correctly and ideally functioning protein.

Spectrometer graph result of absorbance vs. time of Trials 6—8 of activity assays of Tb6pgdh (Sample B/C). The solutions were measured at 340nm in a round-top cuvette. The solutions each contained 250uL of 100mM HEPES buffer, 105uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, 10uL Tb6pgdh (B/C, snap-frozen), and 5uL of 1mM 6PG in 100uL Nanopure water added at approximately 1.5 minutes . Trial 6 is represented by the red graph, Trial 7 by the blue graph, and Trial 8 by the green graph.

Analysis: The graphs all show that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slopes of the graphs are very similar, and the graphs show plateaus (albeit at different levels of absorbance) indicating complete NADP+ reduction after each addition of 6-PG. A better 3n replication will be attempted by combining enough 6PG in water for all three trials, in an effort to reduce the possibility of pipetting errors.


Spectrometer graph result of absorbance vs. time of Trials 9—11 of activity assays of Tb6pgdh (Sample B/C). The solutions were measured at 340nm in a round-top cuvette. The solutions each contained 250uL of 100mM HEPES buffer, 105uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, 10uL Tb6pgdh (B/C, snap-frozen), and 5uL of 1mM 6PG in 100uL Nanopure water added at approximately 1.4 minutes . Trial 9 is represented by the red graph, Trial 10 by the blue graph, and Trial 11 by the green graph.


Analysis: The graphs all show that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slopes of the graphs, although shaky, are very similar, and the graphs show plateaus (albeit at different levels of absorbance) indicating complete NADP+ reduction after each addition of 6-PG. In an effort to reduce the possibility of pipetting errors, enough 6PG in water for all three trials was combined in the appropriate amount of water, and each trial’s 6PG/water combination was taken from this stock. Although the absorbance levels decrease with each trial, the focus will be on achieving a lower slope (slower reaction).

Enzyme Activity Assay: Sample B/C, Trial 2--4 (11/19/13)

Spectrometer graph result of absorbance vs. time of Trial 2 of activity assays of Tb6pgdh (Sample B/C). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 110uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 100ul of 10uM 6-PG was added forcefully at approximately 0.7 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph does not show that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. This could be due to the use of a more dilute 6PG (1:100 instead of 1:10 dilution), but this was compensated for in the amount added. Another, more plausible explanation is that Sample B/C is no longer active. Another trial will be conducted using a 1:10 dilution of 6PG.

Spectrometer graph result of absorbance vs. time of Trial 3 of activity assays of Tb6pgdh (Sample B/C). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 100uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 10ul of 100uM 6-PG was combined with 100uL of Nanopure water and added forcefully at approximately 1.2 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph does not show that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. This implies that Sample B/C is no longer active. Another trial will be conducted using more 6PG.


Spectrometer graph result of absorbance vs. time of Trial 4 of activity assays of Tb6pgdh (Sample B/C). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 100uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 10ul of 1mM 6-PG was combined in 100uL of Nanopure water and added forcefully at approximately 0.7 minutes. 20uL Tb6pgdh (B/C) were added at approximately 2 minutes. AT approximately 3.2 minutes, 10 uL of 1mM 6PG were added. The sharp peaks indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph does not show that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. This implies that Sample B/C is no longer active. Another trial will be conducted using a different tube of snap-frozen Tb6pgdh (B/C), and possibly enzyme stored in glycerol at -20°C.

Enzyme Activity Assay: Sample A, Trial 30--35 (11/19/13)

Spectrometer graph result of absorbance vs. time of Trial 30 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 100uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 10ul of 100uM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is solid, and the graph shows a plateau indicating complete NADP+ reduction. The reaction is happening too quickly, though. Another trial will be performed with less of the substrate 6PG in an attempt to achieve a slower reaction.


Spectrometer graph result of absorbance vs. time of Trial 31 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 105uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 5ul of 100uM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 0.75 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is shaky, but discernible, and the graph shows a plateau indicating complete NADP+ reduction. The reaction is happening too quickly, though. Another trial will be performed with less of the substrate 6PG in an attempt to achieve a slower reaction.


Spectrometer graph result of absorbance vs. time of Trial 32 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 106uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 4ul of 100uM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 0.7 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is shaky, but discernible, and the graph shows a plateau indicating complete NADP+ reduction. The reaction is happening too quickly, though. Another trial will be performed with less of the substrate 6PG in an attempt to achieve a slower reaction.



Spectrometer graph result of absorbance vs. time of Trials 32—34 of activity assays of Tb6pgdh (Sample A). The solutions were measured at 340nm in a round-top cuvette. The solutions each contained 250uL of 100mM HEPES buffer, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. Trial 32 (represented by the blue graph) is described in a separate graph. Trial 33 (represented by the green graph) contained 107uL Nanopure water, and 3ul of 100uM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 0.5 minutes. Trial 34 (represented by the orange graph) contained 108uL Nanopure water, and 3ul of 100uM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.2 minutes. The sharp peaks indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graphs all show that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slopes of the graphs are all shaky, but discernible, and the graphs show a plateau indicating complete NADP+ reduction. The reaction is happening too quickly, though. A trial to recreate Trial 30 will be attempted to ensure that all components are still functioning equally.


Spectrometer graph result of absorbance vs. time of Trial 35 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 100uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 10ul of 100uM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 0.7 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is stable, although not as much as Trial 30 and the graph shows a plateau indicating complete NADP+ reduction at approximately the same absorbance as Trial 30. Another trial will be performed using a more dilute working solution of the substrate 6PG in an attempt to achieve a slower reaction.

Fall 2013 WEEK 11 & 12 (11/4--11/17)-

Enzyme Activity Assay: Sample A, Trial 26--29 (11/16/13)

Spectrometer graph result of absorbance vs. time of Trials 26—29 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a 96 well plate. All solutions contained 50uL of 100mM HEPES buffer, 23uL Nanopure water, 2uL 100mM MgCl2, 2 ul of 1mM NADP+, and 2uL Tb6pgdh. In Trial 26, 0.2ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well. In Trial 27, 0.3ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well. In Trial 28, 0.4ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well. In Trial 29, 0.5ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well.

Enzyme Activity Assay: Sample A, Trial 21--25 (11/16/13)

Spectrometer graph result of absorbance vs. time of Trials 21—25 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a 96 well plate. All solutions contained 50uL of 100mM HEPES buffer, 23uL Nanopure water, 2uL 100mM MgCl2, 2 ul of 1mM NADP+, and 2uL Tb6pgdh. In Trial 21, 0.25ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well. In Trial 22, 0.5ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well. In Trial 23, 1ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well. In Trial 24, 2ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well. In Trial 25, 3ul of 1mM 6-PG was combined with 20uL Nanopure water and added to the well.

Enzyme Activity Assay: Sample A, Trial 13--20 (11/8/13)

Spectrometer graph result of absorbance vs. time of Trial 13 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 109uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 1ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is very shaky, and the graph shows an immediate plateau indicating complete NADP+ reduction. This is probably due to the low concentration of 6PG substrate. Another trial will be performed with more of the substrate in an attempt to achieve a graph that reflects a correctly and ideally functioning protein.

Spectrometer graph result of absorbance vs. time of Trial 14 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 108uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 2ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. The sharp peaks indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is unclear, and the graph shows an almost immediate plateau indicating complete NADP+ reduction after each addition of 6-PG. One issue with this trial is that the cuvette was not calibrated before data collection. In addition, problems could have arisen due to the low concentration of 6PG substrate. Another trial will be performed with more of the substrate in an attempt to achieve a graph that reflects a correctly and ideally functioning protein.


Spectrometer graph result of absorbance vs. time of Trial 15 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 107uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 3ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph, although gradual and upward, is shaky, and the graph does not show a plateau indicating complete NADP+ reduction. This might be due to the low concentration of 6PG substrate. Another trial will be performed with more of the substrate in an attempt to achieve a graph that reflects a correctly and ideally functioning protein.


Spectrometer graph result of absorbance vs. time of Trial 16 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 106uL Nanopure water, 10uL 100mM MgCl2, 20ul of 1mM NADP+, and 10uL Tb6pgdh. 1ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 3 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is steep, and the graph shows a plateau indicating complete NADP+ reduction after the addition of 6-PG. Overall, the graph indicates that the enzyme is working too quickly for the added amount of substrates to be conducive to inhibition testing. Another trial will be run, this time altering the amount of the substrate NADP+ added to solution.

Spectrometer graph result of absorbance vs. time of Trial 17 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 116uL Nanopure water, 10uL 100mM MgCl2, 10ul of 1mM NADP+, and 10uL Tb6pgdh. 4ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.2 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is good, although still too steep to proceed to inhibition assays, and the graph shows a plateau indicating complete NADP+ reduction after the addition of 6-PG. Overall, the graph indicates that the enzyme is still working too quickly for the added amount of substrates to be conducive to inhibition testing. Another trial will be run altering the amount of the substrate NADP+ added to solution.


Spectrometer graph result of absorbance vs. time of Trial 18 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 121uL Nanopure water, 10uL 100mM MgCl2, 5ul of 1mM NADP+, and 10uL Tb6pgdh. 1ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.2 minutes. The sharp peaks indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is steep, and the graph shows a plateau indicating complete NADP+ reduction after the addition of 6-PG. Overall, the graph indicates that the enzyme is working too quickly for the added amount of substrates to be conducive to inhibition testing. Another trial will be run, this time altering the amount of the enzyme added to solution.

Spectrometer graph result of absorbance vs. time of Trial 19 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 126uL Nanopure water, 10uL 100mM MgCl2, 5ul of 1mM NADP+, and 5uL Tb6pgdh. 4ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is steep, and the graph shows a shaky plateau indicating complete NADP+ reduction after the addition of 6-PG. Overall, the graph indicates that the enzyme is working too quickly for the added amount of substrates to be conducive to inhibition testing. Another trial will be run, this time altering the amount of substrates added to solution.

Spectrometer graph result of absorbance vs. time of Trial 20 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 129uL Nanopure water, 10uL 100mM MgCl2, 3ul of 1mM NADP+, and 5uL Tb6pgdh. 2ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. The sharp peak indicates the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is steep, and the graph shows a shaky plateau indicating complete NADP+ reduction after the addition of 6-PG. Overall, the graph indicates that the enzyme is working too quickly for the added amount of substrates to be conducive to inhibition testing. Another trial will be run, this time altering the amount of substrates added to solution.

Enzyme Activity Assay: Sample A, Trial 6--12 (11/7/13)

Spectrometer graph result of absorbance vs. time of Trial 6 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 220uL Nanopure water, 10uL 100mM MgCl2, 30ul of 1mM 6-PG (10uL at 0 min, 10uL added at 5 min, 10uL added at 6.5 min), 30 ul of 1mM NADP+ (10uL added at 0 min, 10uL added at 5.4 min, 10uL added at 6.8 min), and 20uL Tb6pgdh (10uL added at 2 min, 10uL added at 3.5 min).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is good, and the graph shows the beginning of a plateau indicating complete NADP+ reduction. Another trial will be conducted to attempt replication.

Spectrometer graph result of absorbance vs. time of Trial 7 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 220uL Nanopure water, 10uL 100mM MgCl2, 20ul of 1mM 6-PG, 20 ul of 1mM NADP+, and 20uL Tb6pgdh. The sharp peaks between 0 and 5 minutes indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into the cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is borderline flat, and the graph shows a plateau indicating complete NADP+ reduction beginning almost immediately after reduction begins. A possible explanation is that the substrate dilutions were left out on ice too long in between Trial 6 and Trial 7. New dilutions will be made and the assay redone.



Spectrometer graph result of absorbance vs. time of Trial 8 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 220uL Nanopure water, 10uL 100mM MgCl2, 30ul of 1mM 6-PG, 30 ul of 1mM NADP+, and 20uL Tb6pgdh. The sharp peaks between 0 and 7.5 minutes indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into the cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is borderline flat, and the graph, although increasing overall, is very shaky. A possible explanation is that the substrates are not being mixed properly in the cuvette upon addition. They will be added more forcefully in the next trial.



Spectrometer graph result of absorbance vs. time of Trial 9 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 100uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 30ul of 1mM 6-PG was combined with 100uL additional Nanopure water and added forcefully at approximately 1 minute. The sharp peak at 1 minute indicates the addition of a substance to solution (peak caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is steep, and the graph shows a plateau indicating complete NADP+ reduction. This indicates that the problem was proper mixture of the substrates upon addition to the cuvette. Another trial will be performed to attempt reduction of the slope of the graph.



Spectrometer graph result of absorbance vs. time of Trial 10 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 103.5uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 6.50ul of 100uM 6-PG (the volume to reach the Km value of the substrate) was combined with 100uL additional Nanopure water and added forcefully.

Analysis: The slope of the graph is flat, indicating no enzyme activity. This indicates that the Km of 6-PG is not enough volume to sufficiently engage the enzyme. Another trial will be done with a higher concentration of 6-PG.


Spectrometer graph result of absorbance vs. time of Trial 11 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 105uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 5ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 2.5 minutes. The sharp peaks around 2.5 minutes indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is steep, and the graph shows a plateau indicating complete NADP+ reduction. This indicates that the enzyme is still acting too quickly, perhaps due to a higher-than-necessary amount of substrate. Another trial will be performed to attempt reduction of the slope of the graph.



Spectrometer graph result of absorbance vs. time of Trial 12 of activity assays of Tb6pgdh (Sample A). The solution was measured at 340nm in a round-top cuvette. The solution contained 250uL of 100mM HEPES buffer, 109uL Nanopure water, 10uL 100mM MgCl2, 20 ul of 1mM NADP+, and 10uL Tb6pgdh. 1ul of 1mM 6-PG was combined with 100uL Nanopure water and added forcefully at approximately 1.5 minutes. An additional 1uL of 6-PG was added at approximately 3 minutes. The sharp peaks indicate the addition of a substance to solution (peaks caused by inserting the pipette tip into cuvette upon transfer).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is borderline flat, and shaky, and the graph shows almost immediate plateaus indicating complete NADP+ reduction after each addition of 6-PG. This could indicate that the enzyme is still acting too quickly, perhaps due to a higher-than-necessary amount of NADP+. Another trial will be performed in an attempt to produce a slope that increases gradually but visibly over the course of 2 minutes before plateauing.

Fall 2013 WEEK 9 & 10 (10/21--11/3)-

Vicky: Good job on your enzyme assays and analysis! Be sure and update your virtual screening stuff too! - Suman 11/4/13

Enzyme Activity Assay: Sample A, Trial 5 (10/31/13)

Spectrometer graph result of absorbance vs. time of an activity assay of Tb6pgdh (Sample A). The solution was measured at 340nm. The solution contained 50ul of 1mM 6-PG (10uL, 20uL added at 6.5 min, 20uL added at 8.7 min), 50 ul of 1mM NADP+ (10uL added at 0.5 min, 20uL added at 7 min, 20uL added at 9 min), and 70uL Tb6pgdh (10uL added at 2.1 min, 20uL added at 3.5 min, 20uL added at 9 min, 20ul added at 11 min).

Analysis: The graph shows that Tb6pgdh is active and reducing NADP+ to NADPH, which is absorbed at 340nm. The slope of the graph is decent, although there is no plateau to determine complete NADP+ reduction. However, the reaction required much more substrate, and enzyme, to occur than in Trial 1 (10/25/13). This may be due to inactivation of the substrates. The stock dilutions of these will be remade using HEPES buffer instead of Nanopure water.


Enzyme Activity Assay: Sample A, Trials 2--4 (10/30/13)

Spectrometer graph result of absorbance vs. time of five activity assays of Tb6pgdh (Sample A). All solutions contained 250uL of 100mM HEPES buffer, 220uL of Nanopure water, and 10uL of 100mM MgCl2.
Not represented on this graph: Trial 1 was conducted on 10/25/13
Red graph: Trial 2 was completed in a square top cuvette; solution contained 10ul of 1mM 6-PG, 10 ul of 1mM NADP+ (added at 1.5 min), and 20uL Tb6pgdh (10uL added at 2 min, 10uL added at 5.5 min)
Blue graph: Trial 3 was conducted in a round top cuvette; the spectrometer was not calibrated; solution contained 10ul of 1mM 6-PG, 10 ul of 1mM NADP+ (added at 0.6 min), and 20uL Tb6pgdh (10uL added at 1.9 min, 10uL added at 2.5 min)
Green graph: Additional substrates and enzyme were added to Trial 3 solution; 50uL of 6-PG (30uL at 1.7min, 10uL at 6.3 min, 10uL at 9.5min), 50uL of NADP+ (30uL at 2min, 10uL at 6.5 min, 10uL at 9.7min), and 30uL of Tb6pgdh (20uL at 3 min, 10uL at 4.1 min) were added
Orange graph: Trial 4 was conducted in the cleaned round top cuvette; solution contained 40uL of 6-PG, 40 uL of NADP+ (added at 0.5 min), 70uL of Tb6pgdh (30uL added at 0.4 min, 40uL added at 6 min)

Analysis: All trials were measured at 220nm instead of 340nm. The assays will be conducted again and measured at 340nm.

Enzyme Activity Assay: Sample A, Trial 1 (10/25/13)

Figure 1: Spectra of enzyme activity assay of Tb6pgdh. Solution of HEPES buffer, water, MgCl2, 6-PG, NADP, and Tb6pgdh enzyme (Sample A) was measured over 20 minutes and analyzed based on 340nm. The peak at 340nm indicates a correctly functioning protein as NADPH is being produced.



Figure 2: Spectra result of a solution of HEPES buffer, water, MgCl2, 6-PG, and NADP, without the Tb6pgdh enzyme. The lack of a peak at 340nm indicates that NADPH is not present.

Figure 3: Spectra result of a solution of HEPES buffer, water, and NAPDH, without the substrates MgCl2, 6-PG, NADP, and Tb6pgdh enzyme (Sample A). The peak at 340nm indicates the presence of NADPH.

Analysis: The sample of Tb6pgdh being tested indicates an active protein. Figure 2 indicates that NADPH was not found in the buffer or any substrates before adding the enzyme. Figure 3 shows that NADPH is registering correctly at 340nm on the spectra. Figure 1 shows that NADPH is can be found when the enzyme is present in solution, implying that the protein is active and functioning correctly by reducing the NADP+ substrate into an NADPH product.

Virtual Screening: Docking ChemBridge Library



Virtual Screening: Docking cb_306 Library

Fall 2013 WEEK 7 & 8 (10/7--10/20)-

Good work Vicky. Nice captions and analysis. Thank you. -Max 10/21/13
Virtual Screening: Docking Negative and Positive Controls**

Non-inclusive list of positive and negative controls docked in Tb6pgdh. 5RP scored 44.68 and will be used to define the active site when docking novel ligand libraries.

Analysis: The crystal structure of our target (1PGJ) does not have any ligands in the active site, just two sulfate ions. A bacterial version of the protein with ligands in the active site was found and aligned to Tb6pgdh. Kavya K. worked to define the active site using one ligand, NADP, and I did the same with 5RP. The ligand was docked into Tb6pgdh (GOLD score of (44.68). The result will be used to define the active site for novel ligand docking.

Virtual Screening: Defining the Active Site of Tb6pgdh

5-ribulose phosphate (5RP) from bacterial 6-phosphogluconate dehydrogenase (2IYP) aligned to the target 6-phosphogluconate dehydrogenase in Trypanosoma brucei (Tb6pgdh). Tb6pgdh is shown as lines with carbon in green, with sulfate ions shown as sticks with carbon in yellow. 5RP is shown as sticks with carbon in green. Nitrogen is in blue, oxygen is in red, sulfur is in orange, and hydrogen is in grey.

5-ribulose phosphate (5RP) from bacterial 6-phosphogluconate dehydrogenase (2IYP) aligned to the target 6-phosphogluconate dehydrogenase in Trypanosoma brucei (Tb6pgdh). Tb6pgdh is shown as lines with carbon in green, with sulfate ions removed. 5RP is shown as sticks with carbon in green. Nitrogen is in blue, oxygen is in red, sulfur is in orange, and hydrogen is in grey.

5-ribulose phosphate (5RP) from bacterial 6-phosphogluconate dehydrogenase (2IYP) docked in what is determined to be the active site of the target 6-phosphogluconate dehydrogenase in Trypanosoma brucei (Tb6pgdh). Tb6pgdh is shown as surface with carbon in green (sulfate ions have been removed). 5RP is shown as sticks with carbon in yellow. Nitrogen is in blue, oxygen is in red, sulfur is in orange, and hydrogen is in grey.

Protein Purification--FPLC: Sample B and C Combined (10/7/13)

Nanodrop results of Samples B (from 10mL plate, 25 deg growth) and C (from 50mL plate, 25 deg growth) of Tb6pgdh combined after FPLC. Concentration is 2.255 mg/mL.

Fall 2013 WEEK 5 & 6 (9/23--10/6)-

Good job with your captions. Try to add a brief analysis of nanodrop. Thank you. -Max 10/07/2013

Protein Purification--Nickel Column: Sample C (9/28/13)

Nanodrop result of elution 1 (2ml of elution buffer) of Tb6pgdh protein (Sample C, from the 50mL plate, grown at 25 deg) purified with a nickel column. Concentration is 11.305 mg/ml

Nanodrop result of elution 2 (4ml of elution buffer) of Tb6pgdh protein (Sample C, from the 50mL plate, grown at 25 deg) purified with a nickel column. Concentration is 1.255 mg/ml

Protein Purification--Nickel Column: Sample B (9/28/13)**

Nanodrop result of elution 1 (2ml of elution buffer) of Tb6pgdh protein (Sample B, from the 10mL plate, grown at 25 deg) purified with a nickel column. Concentration is 8.565 mg/ml.


Nanodrop result of elution 2 (4ml of elution buffer) of Tb6pgdh protein (Sample B, from the 10mL plate, grown at 25 deg) purified with a nickel column. Concentration is 1.10 mg/ml

Week 3 & 4 9-Sep - 22-Sep

- Vicky - great work - 10/01/13 - Dr. B

Protein Storage: Sample A (9/20/13)
0.5ml of Tb6pgdh protein was stored in glycerol in -20 degrees. 0.5ml of Tb6pgdh was snap-frozen in liquid Nitrogen and stored in -80 degrees in 70uL aliquots.

Note: This sample may be used in enzyme assays due to the appearance of a peak in the FPLC results. However, it should be used with caution due to the errors involved in its growth and purification. These errors include growth at 37 degrees for 4 hours (it is believed that the protein has a higher chance of denaturing beginning at 37 degrees), eluting with 2ml of elution buffer during Ni+-column purification without allowing the buffer to sit in the column for any extended period of time, loss of at least half of the sample due to an exploding loop in the FPLC machine, and the collection of FPLC samples from glass tubes in the carousel that are highly suspected to be contaminated (even though the samples were syringe-filtered before concentrating after FPLC, chances of contamination are still high).

Protein Purification--FPLC: Sample A (9/20/13)

Protein Yield table entry of Tb6pgdh sample A. Yield was 0.23mg in 500ml.

Nanodrop result of syringe-filtered, FPLC-purified Tb6pgdh protein (sample A). Concentraion is 0.42mg/ml.

FPLC result of concentrated Tb6pgdh protein (sample A--from 10ml plate, grown at 37 degrees). A small peak is visible around the 50ml mark. Samples 28-36 were collected in a 15ml conical tube and syringe-filtered.


Nanodrop results of 3 buffers used in nickel column purification, as well as concentrated Tb6pgdh protein and waste. Based on the A280 readings, most of the imidazole from the elution buffer should be in the waste of the concentrated protein.

Protein Characterization--SDS Page Gel: Sample A (9/19/13)

SDS page gel result of Tb6pgdh protein sample A (10ml plate, grown at 37 degrees).
Lane 1: Cell lysate before induction
Lane 2: Cell lysate after induction
Lane 3: Skipped (well was punctured; possible contamination from lane 2)
Lane 4: Soluble fraction
Lane 5: Flow-through
Lane 6: Wash
Lane 7: Elution 1
Lane 8: Elution 2
Lane 9: Elution 3
Lane 10: ColorPlus protein ladder (10-230 kDa)

Protein Purification--Nickel Column: Sample A (9/19/13)

Nanodrop result of elution 1 (2ml of elution buffer) of Tb6pgdh protein (Sample A, from the 10mL plate, grown at 37 deg) purified with a nickel column. Concentration is 0.845 mg/ml.



Nanodrop result of elution 2 (5ml of elution buffer) of Tb6pgdh protein (Sample A, from the 10mL plate, grown at 37 deg) purified with a nickel column. Concentration is 0.04 mg/ml.


Nanodrop result of elution 3 (5ml of elution buffer) of Tb6pgdh protein (Sample A, from the 10mL plate, grown at 37 deg) purified with a nickel column. Concentration is 0.02 mg/ml.

Protein Expression (9/10/13-9/11/13)

Approximately 13 mL of protein suspended in lysis buffer.
Sample of Tb6pgdh in Bl-21(DE3) taken from 10mL sample plate.

Approximately 13 mL of protein suspended in lysis buffer.
Sample of Tb6pgdh in Bl-21(DE3) taken from 50mL sample plate.

Protein Expression (9/7/13

Approximately 7 mL of protein suspended in lysis buffer.
Sample of Tb6pgdh in Bl-21(DE3) taken from 10mL sample plate.

Protein Transformation (9/5/13)

10mL of Tb6pgdh in Bl-21(DE3) competent cells on LB+Kan+Suc plate.


50mL of Tb6pgdh in Bl-21(DE3) competent cells on LB+Kan+Suc plate.


Fall 2013 WEEK 1 & 2-
Vicky - ok good. Add in some notes about expression - DR. B 090913

Designing Primer for 500 bp (Kavya's sample)
Forward Primer:UPSTREAM
5’ AGCGGACGATGGTCGC 3’ 16 bp
GC Content 68.8%
0.4 uM Oligo 50 mM Na+ 0.3 dNTPs


0 mM Mg2+ Tm 59.2 oC 1.5 mM Mg2+ Tm 63.8 oC 2 mM Mg2+ Tm 64.6 oC
4 mM Mg2+ Tm 66.1 oC 6 mM Mg2+ Tm 66.8 oC

First DNA Sequencing Results for Tb6pgdh in pNic-Bsa4

Forward primer, sample 4
Unfiltered core result (1236 bp):
NNNNNNNNNNNNNNNNNCNNNNNGANANNNNTNNTNNCCNTNNTCNTCTNNTTCTTCTGNTGNNATTTGGNTANTNTGNACCTGTACTTCGATCCCCGTTNTGGNCTTTGNGTNAGTTGGTTTGGGNGNCTC
TNTNCGGNNNNNNNNNCNCNTCTNNNNAAAACGGNTNTNAGTTGCNGTTTTNNNNCNNACNTCTCTAAATCNNANNAATTNATGANAGNNAACGCTTCTGCACCGTTTGTNGGCAACCTGAANGCNTTTGAT
ACCATGGAAGCATTTGCGGCGTCTNTCCTCAAACCNCNNAANTTNCTCATTCTGGTACNNNCGGGTGCGGCCACCGACTCTACCATCNAANNNTCNAAAANANTATTTGAAAAGGGTGACNTCCNGNTCAAC
NCCGGTAACGCGCATTTCANGGACCNNNGTCNTCNNGNNCAGCANCTGGAGGCTGCGGGTCTCCGTTTCCTCGNNATGGGTATTTCTGGTGNNNNNNNANGNGCNCGTNNNGNTNCNGNNNNCTTCCCNGGT
GGNNCCCTGTCTGTATGGGAAGAGATTCGTCCNATCGTTGAACCTGCCNCTGCNNNNNCNNACNATGGTCNNNCGTGCNTNNNNCTNAATGGTTCCGGTGGNGCTGGTTCTNGCTTTAAAATGTNCCACAAC
AGCNGTGANTNNTCTATCCTGCANATCTGGGGTGAAGTATTCCATATCCTGCNNGCGATGGGNNTGAATAATGACNATGCNNCCGNNNNTCTGGAACANTGNANNANCNNAAACTTTNNCAAATCCNNNANG
CTTNNANNTNTNCATCNCTGCNGNACNCTCTAAANANAANGACNGNTCCNNCCTGATCGAGCACGTGTTNGANNGTATCGATANCNAAGGTACCNGNNTGTNGTCTGCCCANNNATCGCTGGAAATNNNTGT
NCCTGCNNCNTCCCNGAACNTGNNNGTNNTTTCNCGCNNNTTCACCNTGTACANANNNNNNNTCNNNNNNTNCNNCTANNNNNNCNGGNNNTNNNNNNNTCTNCTGGNTACNCCCNGAAAAACAAATCNNNN
TNTNGGTCNGNAAANNAANNANNNNNNCNANTCTGTTTGNNNTGCNATCNNNNNNNNNNNNCNCCCNAANGNTNNNNNNNNNCNNNNNNNGNNCAAANNNNNATTNNNNNNNNNCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCNNGGNNNNNNNNNTNNNANNCCNNNNNNNNNNN

BLAST comparison (to filtered DNAWorks gene sequence):



"N" with probable match: 116
"N" with questionable match: 26
Mismatch: 42
Insertion/Deletion: 3
Errors are found throughout, so probably not a good choice to use.

Reverse primer, sample 4
Unfiltered core result (1278 bp):
NNNNNNNNNNNNNNNNNNNNCTCNNNGGTGGNGGTGGTGNGTGCTCGAGTGCGGCCGCAAGCTTGTCGACGGAGCTCGAATTCGGATCCGTATCCACCTTTACTGTTATTGCAGCTCCGGCCACTGAAAAG
ATTCGCGGCCATCTTTGTCAACACGTTCGTAACCATGACGACCGAAAACGTCACGCTGCAGAGAAACGAGCTGGCCATATTTCAGCGTCGGAGTGAACATAGCGGTTACGTAGTTCAGGCTCGCGCTCAGA
ACTGGGATAGAAACTTCCAGTTTAGAGGTAATCAGAGCAACCATATCACGATAGTTTTGGAGGCCGGCACGGATCTCAGTTTGGAATGCGCACATGAGGTTAGAGATGTTCGGATTTTTCTCGAATGCCTC
CGTCATCGGTTTCAGCAGGTAACCCTGGAGGATACAGCCCGCACGAAAGGTCGCGATAGTCGCTGGGAGGTTGAGGCCGAAATTGTGAACTTTGTCCATTTCACGCAGGCATTGGAACATTTGGGCGTAGC
AAGAGATGATCGCAATGCAAACAGAGTCGTACAGTTGTTTGATTTCCGGACCAGACGGAGATTTGTTTTTCAGGGTGTAACCAGGAGACTGGGTGATACCCGGAGCGTTAGACGCATTCGCCTGACGTTCG
GTCTTGTACATGGTGAATTGGCGGGAAACTACCGCCATGTTCAGGGATGGCGCAGGTACACCGATTTCCAGCGCTTCCTGGGCAGACCACAGACCGGTACCTTTGCTACCGATACGGTCCATCACGTGCTC
GGTCAGGTAGGAGCCGTCCTTGTCTTTAGCGCGTGCCGCAGCGATGGAGATGTCCAGCATATAGGATTTGAGAAAGTTTTTGCTTTTCCAGTCTTCCAGAACCGNNGGCTACTTCGTCATTATTCAGGCCC
ATCGCGCGCNNGATATCGAATACTTCACCCCAGATTTGCANGATCNNGTATTCNNCGCTGTTGTGGTACATTTTAACGCAAGAACCNNCACCANCNGGNACCATTCATCGTTACNCACGGGCNACCATCGT
CNNNTTTCNCANCGGCNNCTTNNNGATCGGANNNANNTCTTNCCNNNACNGNACAGGGNNNNACCCNGGNNNNANNNNNNANCCNTTNNCNNNNNNNNNNNTTNNCNACCNNAANNNNNCANNNNNNNNNN
ANNNNNANCNNNANNNNNNNTGNNNNNGNNNNANNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNTNNNNCNNTTTNNNNNNNNNNNN

BLAST comparison (to filtered DNAWorks gene sequence):


"N" with probable match: 9
"N" with questionable match: 4
Mismatch: 1
Insertion/Deletion: 2
Errors are found in the beginning of the sequence, which overlaps with the sequence from the forward primer. Considering how error-ridden the forward sequence is, this is still probably not a good choice to move forward with.

Forward primer, sample 12
Unfiltered core result (1253 bp):
NNNNNNNNNNNNNNNNNNNTTTAGANGAGATATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGTCTATGGA
CGTTGGTGTAGTTGGCCTGGGTGTTATGGGTGCGAACCTGGCGCTGAATATTGCGGAAAAAGGTTTCAAAGTTGCGGTTTTCAACCGTACCTACTCTAAATCTGAAGAATTTATGA
AAGCGAACGCTTCTGCACCGTTTGCGGGCAACCTGAAGGCGTTTGAGACCATGGAAGCATTTGCGGCGTCTCTCAAGAAACCGCGTAAAGCGCTCATTCTGGTACAAGCGGGT
GCGGCCACCGACTCTCCATCGAACAGCTCAAAAAAGTATTTGAAAAGGGTGACATCCTGGTCGACACCGGTAACGCGCATTTCAAGGACCAGGGTCGTCGTGCGCAGCAGCTG
GAGGCTGCGGGTCTCCGTTTCCTCGGCATGGGTATTTCTGGTGGTGAAGAAGGTGCGCGTAAGGGTCCGGCGTTCTTCCCGGGTGGTACCCTGTCTGTATGGGAAGAGATTC
GTCCGATCGTTGAAGCTGCCGCTGCGAAAGCGGACGATGGTCGCCCGTGCGTAACGATGAATGGTTCCGGTGGTGCTGGTTCTTGCGTTAAAATGTACCACAACAGCGGTGAA
TACGCGATCCTGCAAATCTGGGGTGAAGTATTCGATATCCTGCGCGCGATGGGCCTGAATAATGACGAAGTAGCCGCGGTTCTGGAAGACTGGAAAAGCAAAAACTTTCTCAAAT
CCTATATGCTGGACATCTCCATCGCTGCGGCACGCGCTAAAGACAGGACGGCTCCTACCTGANCGAGCACGTGATGGACCGTATCGGTAGCAAAGGTACCGGTCTGTGGTCTG
CCCAGGAAGCGCTGGAAATCGGTGTACCTGCGCCATCCCTGAACATGGCGGTAGTTTCCCGCCAATTCACCATGTACAAGACCGAACGTCAGGNGAATGCGTCTAACGCTNCN
GGTATCACCCAGTCNNCTGGNTACNNCCNNAAAAANNAATCTNCGTCTGGNNNNNNCAAACNACTGTACGACTNNNNNNTTGCATTGCNATCATNNNNNTGNTACNCCNNAN
NNNNNNNNNNNNNNNNAAATNNNNANNNNNNNNNNNNNNNNNNNNNNNCNNNNNGNNNNNNNNGNNNNNNNCNCNNGNNANCNNNTNANNNANNNNGNANGNNNT
NNNNNNNAAAAAAA
BLAST comparison (to filtered DNAWorks gene sequence):


"N" with probable match: 10
"N" with questionable match: 2
Mismatch: 2
Insertion/Deletion: 2
Errors are found mostly at the end of the sequence. However, a deletion occurs at 359 bp and 841 bp, which could indicate a frameshift, in which case the sample is unusable.

Reverse primer, sample 12

Unfiltered core result (1269 bp):
NNNNNNNNNNNNNNNNNNNNNNNNCAGTGGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCNAGCTTGTCGACGGAGCTCGAATTCGGATCCGTATCCACCTTTACTGTT
ATTGCAGCTCCGGCCACTGAAAAGATTCGCGGCCATCTTTGTCAACACGTTCGTAACCATGACGACCGAAAACGTCACGCTGCAGAGAAACGAGCTGGCCATATTTCAGCGTC
GGAGTGAACATAGCGGTTACGTAGTTCAGGCTCGCGCTCAGAACTGGGATAGAAACTTCCAGTTTAGAGGTAATCAGAGCAACCATATCACGATAGTTTTGGAGGCCGGCACGG
ATCTCAGTTTGGAATGCGCACATGAGGTTAGAGATGTTCGGATTTTTCTCGAATGCCTCCGTCATCGGTTTCAGCAGGTAACCCTGGAGGATACAGCCCGCACGAAAGGTCGC
GATAGTCGCTGGGAGGTTGAGGCCGAAATTGTGAACTTTGTCCATTTCACGCAGGCATTGGAACATTTGGGCGTAGCAAGAGATGATCGCAATGCAAACAGAGTCGTACAGTTGT
TTGATTTCCGGACCAGACGGAGATTTGTTTTTCAGGGTGTAACCAGGAGACTGGGTGATACCCGGAGCGTTAGACGCATTCGCCTGACGTTCGGTCTTGTACATGGTGAATTGG
CGGGAAACTACCGCCATGTTCAGGGATGGCGCANGTACACCGATTTCCAGCGCTTCCTGGGCAGACCACANGACCGGTACCTTTGCTACCGATACNGTCCATCACGTGCTCG
GTCAGGTANGAGCCGTCCTGTCTTTAGCGCGTGCCGCAGCGATGGAGATGTCCAGCATATAGGATTTGAGAAAGTTTTTGCTTTTCCAGTCTTCCANAANCGCNGCTACTTCGT
CATTATTCAGGCCCNTCGCGCGCAGGATATCNAATACTTCACCCCANATTTGCAGGATCGCGTATTCNNCGCTGTTGTGGNNNCATTTTACGCAGAACCANCNCCANNGAANC
ATTCATCGTTACNNCACGGGCGANCATCGTCCNCTTTNNCAGNGNAGCTTNNACNATCNGNNNANNNNTTCCNNNNNNNNNNGGNNCCANNNNNAGANNNNNNNCCCNT
ACNNNNCNCNTNNNTCNCCNNCNNAANNNCNNTNCNNNNAANNNANNCNNNNNCNNNNNNNNNNNGNNNNANNANCNNNNNNNNANNNNNNNNNNNNTNNNNNNN
NNNNNNCNNNNNNAANNNCNTTTTNNNNNNNNNNNNANN
BLAST comparison (to filtered DNAWorks gene sequence):


"N" with probable match: 10
"N" with questionable match: 9
Mismatch: 2
Insertion/Deletion: 7
Errors are found towards the beginning of the sequence, which will overlap with the forward primer sequence. However, several insertions/deletions occur, which could lead to a frameshift, making the sample unusable.

Forward primer, sample 14

Unfiltered core result (1026 bp):
NNNNNNNNNNNNNNGNNNNNNNNCGNNNANANNTCCTCNNNNNNGNNCNNNTANCGTCTGNNGNNNNCANNNNAAANGNTATGGGGAAGTAGGGAGGTACCGCC
TTGTTCACATTACTGTGACTGGNTTGCNCNNNCCTCTTCGGGAANCGTACGTNCCCCTCTCNGANNNNCGGNNCTGTNNTGTNNTGNNGNNNNATTCACTGNGCGTNC
NTGNANTGAGTCGNATTAACGCGTTGTGAATTTNTACTGATTCNNTCTNNAATTGCNATTGTTGNNNTCATTTTGAGGNNTTCCTCCCTAATCAATGTTTAATTTTAGTACACAA
NAACTGTACCCCNTTGCCANGNAAAGGGCGTNACCCTTCTCAGACAANNACNAGNNNTCNGTACNCTTGCAAGANTTNNNNGCNNNNNNGCNANNNCCTNTTTCCTCCC
NTCNATTAAGCATNCNNGTNTAGGGNANCNNCNCTTAGGGTNNAGTCTTGGTAAGNTCANATTNNAGGCATCGCTTTCNTTTCGTTNCNNTANGNTCTCCTACNNATGGNN
NNNTGTGGTGNTNACAGANANNTCNNCNACCATAACNNANCNTTNNNTGTNNNTGAAGATACNNANNCTTTCNCCTANCGACNCNCNACCNAAATCTGAAANTTGCNNACA
GTGANCACNANNTANACCTTANATCTGATNAACANTGTNACTCANNCNTACCCNNATNNNCTNNNGTNACTCNNNANNTNNNNNCNNTGCTNNNGTANCNGNATNNGCTT
CNCNTNTNNNNNNNNGNNNNNTGGNTTCNGTGTANCCTGANTNNTNNACCNNAACTACTNNNCNNACNCGACNTCAGNNCGCANNTGANGGNNNGTNNNGANCNNNG
NANNNNCTGNNTGTGNNNANTTANCNNCNTNTTNNCATNGAGACTNNNTCCCNNNGNNNGNGGNNNNGNCNNNNNNNNNNNNCNNNNNNNNNNNANAGNNNNTNG
ANNNNNNCCNAANNNNNNCNNNNNNNNNNNNNTNNNNNNNNNNNNN
BLAST comparison (to filtered DNAWorks gene sequence):
NO SIGNIFICANT SIMILARITIES FOUND
This sample is included because the accompanying reverse primer sequence is the most promising. This sample should be resubmitted for sequencing.

Reverse primer, sample 14

Unfiltered core result(1273 bp):
NNNNNNNNNNNNNNGNNCTCNGTGGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTTGTCGACGGAGCTCGAATTCGGATCCGTATCCACCTTTACTGTTATTGCA
GCTCCGGCCACTGAAAAGATTCGCGGCCATCTTTGTCAACACGTTCGTAACCATGACGACCGAAAACGTCACGCTGCAGAGAAACGAGCTGGCCATATTTCAGCGTCGGAGT
GAACATAGCGATTACGTAGTTCAGGCTCGCGCTCAGAACTGGGATAGAAACTTCCAGTTTAGAGGTAATCAGAGCAACCATATCACGATAGTTTTGAGGCCGGCACGGATCTCA
GTTTGGAATGCGCACATGAGGTAGAGATGTTCGGATTTTTCTCGAATGCCTCCGTCATCGGTTTCAGCAGGTAACCCTGGAGGATACAGCCCGCACGAAAGGTCGCGATAGTC
GCTGGGAGGTTGAGGCCGAAATTGTGAACTTTGTCCATTTCACGCAGGCATTGGAACATTTGGGCGTAGCAAGAGATGATCGCAATGCAAACAGAGTCGTACAGTTGTTTGATTT
CCGGACCAGACGGAGATTTGTTTTTCAGGGTGTAACCAGGAGACTGGGTGATACCCGGAGCGTTAGACGCATTCGCCTGACGTTCGGTCTTGTACATGGTGAATTGGCGGGAA
ACTACCGCCATGTTCAGGGATGGCGCAGGTACACCGATTTCCAGCGCTTCCTGGGCAGACCACAGACCGGTACCTTTGCTACCGATACGGTCCATCACGTGCTCGGTCAGG
TAGGAGCCGTCCTTGTCTTTAGCGCGTGCCGCAGCGATGGAGATGTCCAGCATATAGGATTTGAGAAAGTTTTTGCTTTTCCAGTCTTCCAGAACCGCGGCTACTTCGTCATTA
TTCAGGCCCATCGCGCGCAGGATATCGAATACTTCACCCCAGATTTGCAGGATCGCGTATTCACCGCTGTTGTGGTACATTTTAACGCAAGAACCAGCACCACCGGAACCATTC
ATCGTTACGCACGGGNNANCATCGTCCGCTTTCGCAGCGGCAGCTTCNACGATCGGACGAANCTCNTNCCATANNNACAGGGNANNNCCCNGGANNANNNNNACCNNNA
CGCNNNNNNNNNTNNNCNNCNNAANNNCCNNNCNNNNNANCGGNNNNCNNCANCNCNNNNNGNNTGNNNNNNANNANNNNNNNNNNNNNNNNNNNNNNANNNNN
NNNNNNNNNNNTNNCNNNNNNANNNNNNTTTTNNNNNNCNNNNNN
BLAST comparison (to filtered DNAWorks gene sequence):


"N" with probable match: 6
"N" with questionable match: 1
Mismatch: 1
Insertion/Deletion: 2
Errors are found in the beginning and end of the sequence. The majority of the errors at the beginning of the sequence are probable matches, with one slightly questionable match. There are two deletions near the end of the sequence (beginning of the reverse primer strand) at 317 bp and 356 bp, along with one mismatch at 232 bp. This is by far the sample with the best results, and could possibly be used, if the forward primer sequence comes back with good results once re-sequenced.

Summer 2013 WEEK 9-

Nanodrop spectrometer readings of MiniPrep result of Tb6pgdh in pNic. DNA extracted from plate with 2:4 vector to insert ratio.

Sample 1: 67.1 ng/ul


Sample 2: 51.55 ng/ul


Sample 3: 67.85 ng/ul


Sample 4: 73.4 ng/ul


Sample 5: 59.15 ng/ul


Sample 6: 59.25 ng/ul


Sample 7: 67.85 ng/ul


Sample 8: 65.55 ng/ul

Nanodrop spectrometer readings of MiniPrep result of Tb6pgdh in pNic. DNA extracted from plate with 1:4 vector to insert ratio.

Sample 1: 68.55 ng/ul


Sample 2: 72.05 ng/ul


Sample 3: 73.1 ng/ul


Sample 4: 70.95 ng/ul


Sample 5: 63.15 ng/ul


Sample 6: 45.4 ng/ul


Sample 7: 61.1 ng/ul


Sample 8: 56.95 ng/ul

Summer 2013 WEEK 8-

Due to the lack of success cloning into pUC19, I will be moving forward using Kavya's plates of colonies (pNIC).
Plate Results of Tb6pgdh in pUC19

Plate A (1:3 vector to insert) No white colonies


Plate B (1:6 vector to insert) No white colonies


Plate C (1:9 vector to insert) No white colonies

Plate D (1:0 vector to insert--control) No white colonies

RE Digest of pUC19 Plasmid

Lane 1: 1 kb DNA ladder
Lane 2: stock pUC19 plasmid
Lane 3: tube “A” of cut plasmid
Lane 4: tube “B” of cut plasmid

Nanodrop: PCR Clean-up of pUC19 Vector



Nanodrop: PCR Clean-up of Tb6pgdh Insert (with first and last overlap primers)


PCR Squared (2 samples) and Secondary PCR (7/8 samples)

Lane 1: 1kb DNA ladder
Lanes 2-3 are PCR2, extended annealing and extension times, first and last
oligo mix, 2° PCR from 7/19 (tube 8)
Lane 2: Annealing 60.3°C
Lane 3: Annealing 58°C
Lanes 4-10 are 2° PCR, extended annealing and extension times, with
designed tail primers (7/18), 1° PCR made 7/19 (tube 3) with 7/2
oligo mix, gradient annealing temp.
Lane 4: Annealing 66°C
Lane 5: Annealing 65.6°C
Lane 6: Annealing 64.7°C
Lane 7: Annealing 63.1°C
Lane 8: Annealing 61.2°C
Lane 9: Annealing 59.6°C
Lane 10: Annealing 58.5°C

Secondary PCR (8/8 samples)

Lane 1: 100bp DNA ladder
Lanes 2-9 are JIE’s
Lane 10: Annealing 58°C

WEEK 7-

Secondary PCR with first and last overlapping primers

07/19/13
Lane 1: 1 kb DNA ladder
Lane 2: Annealing 77°C
Lane 3: Annealing 76.4°C
Lane 4: Annealing 75.1°C
Lane 5: Annealing 73.3°C
Lane 6: Annealing 71°C
Lane 7: Annealing 69.4°C
Lane 8: Annealing 68°C
Lane 9: Annealing 67°C

Secondary PCR with designed FOR and REV primers

07/19/13
Lane 1: 1 kb DNA ladder
Lane 2: Annealing 77°C
Lane 3: Annealing 76.4°C
Lane 4: Annealing 75.1°C
Lane 5: Annealing 73.3°C
Lane 6: Annealing 71°C
Lane 7: Annealing 69.4°C
Lane 8: Annealing 68°C
Lane 9: Annealing 67°C

Primary PCR of Tb6pgdh


07/19/13
Lane 1: 1kb DNA ladder
Lane 2: Primary sample using oligo mix from 7/2
Lane 3: skipped
Lane 4: Primary sample using oligo mix from 7/19

Secondary PCR and Primary PCR for Tb6pgdh

07/18/13
Lane1: 1 kb DNA ladder
Lane 2: KK sample 7
Lane 3: KK sample 8
Lane 4: skipped
Lane 5: VLG primary sample A
Lane 6: VLG primary sample B
Lane 7: VLG primary sample C

PCR Squared and secondary PCR of Tb6pgdh

07/18/13
Lanes 1-6 are VLG’s
Lane 1: 100 bp DNA ladder
Lane 2: 1kb DNA ladder
Lane 3: skipped
Lane 4: PCR2 result (made 7/17)
Lane 5: Secondary PCR (new primers, made 7/18)
Lane 6: skipped
Lanes 7-12 are VLG’s
Lane 7: 100 bp DNA ladder
Lane 8: 1kb DNA ladder
Lane 9: skipped
Lane 10: PCR2 result (made 7/17)
Lane 11: skipped
Lane 12: Secondary PCR (new primers, made 7/18)

PCR Squared of Tb6pgdh

07/17/13
Lane 1: 1kb Ladder
Lane 2: Secondary PCR sample A2 (59°C Annealing Temp)
Lane 3: Secondary PCR sample C2 (57.8°C Annealing Temp)

Secondary PCR for Tb6pgdh

7/17/13
Secondary Overlap PCR Re-Run previous (7/16) OL PCR
Lane 1: 1kb Ladder
Lane 2:Secondary PCR sample (58°C Annealing Temp)
Lane 3: Secondary PCR sample (51°C Annealing Temp)
Lane 4:Secondary PCR sample (58°C Annealing Temp)-VLG
Lane 5: Secondary PCR sample (51°C Annealing Temp)-VLG
Lane 6:Secondary PCR sample B2 (58.6°C Annealing Temp)
Lane 7:Secondary PCR sample G1 (52.5°C Annealing Temp)

Secondary PCR for Tb6pgdh

07/16/13
Lane 1: 1kb DNA ladder
Lanes 2-7 are KK’s
Lane 2: Sample H1, standard protocol, 59°C
Lane 3: Sample G1, standard protocol, 58.6°C
Lane 4: Sample B2,standard protocol, 52.5°C
Lane 5: Sample A2, standard protocol, 52°C
Lane 6: Secondary PCR, NEB suggested protocol, 58°C annealing
Lane 7: Secondary PCR, NEB suggested protocol, 52°C annealing
Lane 8-9 are VLG's
Lane 8: Secondary PCR, standard protocol, 58°C annealing
Lane 9: Secondary PCR, standard protocol, 51°C annealing

Summer 2013 WEEK 6-

Secondary PCR for Tb6pgdh, Altering tail/overlap primers and concentration of template and polymerase

07/13/13
*Note: "Protocol 1" is standard PCR settings, "Protocol 2" is NEB/Q5 recommended settings*
Lane 1: 1 kb DNA ladder
Lane 2: Protocol 1, FOR/last overlap
Lane 3: Protocol 1, first overlap/REV
Lane 4: Protocol 2, FOR/last overlap
Lane 5: Protocol 2, first overlap/REV
Lane 6: Protocol 1, FOR/REV, more template and polymerase
Lane 7: Protocol 2, FOR/REV, more template and polymerase

Vicky - keep trying - you guys will get it eventually. Dr. B 071713
Secondary PCR for Tb6pgdh, Gradient annealing temperature (deg C) (third attempt)

Lane 1: 1kb DNA ladder
Lane 2: Sample B1 (63 deg)
Lane 3: Sample B2 (62.6 deg)
Lane 4: Sample B3 (61.7 deg)
Lane 5: Sample B4 (60.1 deg)
Lane 6: Sample B5 (58.28 deg)
Lane 7: Sample B6 (56.6 deg)
Lane 8: Sample B7 (55.5 deg)
Lane 9: Sample B8 (55 deg)

Secondary PCR for Tb6pgdh, Gradient annealing temperature (deg C) (second attempt)
`
Lane 1: 1kb DNA ladder
Lane 2: Sample A1 (72 deg)
Lane 3: Sample A2 (71.6 deg)
Lane 4: Sample A3 (70.7 deg)
Lane 5: Sample A4 (69.1 deg)
Lane 6: Sample A5 (67.2 deg)
Lane 7: Sample A6 (65.6 deg)
Lane 8: Sample A7 (64.6 deg)
Lane 9: Sample A8 (64 deg)

Secondary PCR for Tb6pgdh, Gradient annealing temperature (deg C) (first attempt)

Lane 1: 1kb DNA ladder
Lane 2: Sample 1 (64 deg)
Lane 3: Sample 2 (65.2 deg)
Lane 4: Sample 3 (66.8 deg)
Lane 5: Sample 4 (68.8 deg)
Lane 6: Sample 5 (71.5 deg)
Lane 7: Sample 6 (73.7 deg)
Lane 8: Sample 7 (75.2 deg)

pNic Comparison BLAST


Possible Mismatches: Query nucleotides 933, 950, 1018, 1025, 1039, 1041, 1045, 1047,
Deletion/Insertion: Query nucleotide 947

pNic Nucleotide BLAST

>filtered DNA sequence consisting of 1270 bases.
NNNNNNNNNNNNNNNNNNNNNTTNNNNNGAGATATACATATGCACCATCATCATCATCAT TCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGAGACCGACGTC CACATATACCTGCCGTTCACTATTATTTAGTGAAATGAGATATTATGATATTTTCTGAAT TGTGATTAAAAAGGCAACTTTATGCCCATGCAACAGAAACTATAAAAAATACAGAGAATG AAAAGAAACAGATAGATTTTTTAGTTCTTTAGGCCCGTAGTCTGCAAATCCTTTTATGAT TTTCTATCAAACAAAAGAGGAAAATAGACCAGTTGCAATCCAAACGAGAGTCTAATAGAA TGAGGTCGAAAAGTAAATCGCGCGGGTTTGTTACTGATAAAGCAGGCAAGACCTAAAATG TGTAAAGGGCAAAGTGTATACTTTGGCGTCACCCCTTACATATTTTAGGTCTTTTTTTAT TGTGCGTAACTAACTTGCCATCTTCAAACAGGAGGGCTGGAAGAAGCAGACCGCTAACAC AGTACATAAAAAAGGAGACATGAACGATGAACATCAAAAAGTTTGCAAAACAAGCAACAG TATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCAACTCAAGCGTTTGCGAAAGAAA CGAACCAAAAGCCATATAAGGAAACATACGGCATTTCCCATATTACACGCCATGATATGC TGCAAATCCCTGAACAGCAAAAAAATGAAAAATATAAAGTTCCTGAGTTCGATTCGTCCA CAATTAAAAATATCTCTTCTGCAAAAGGCCTGGACGTTTGGGACAGCTGGCCATTACAAA ACACTGACGGCACTGTCGCAAACTATCACGGCTACCACATCGTCTTTGCATTAGCCGGAG ATCCTAAAAATGCGGATGACACATCGATTTACNTGTTCTATCAAAAGTNGGCGAAACTTC TATTGACAGCTGGAAAAACGCTGGCCGCGTCTTTAAAGACAGCGACAAATTCGATGCNAA TGATNCTATCCTAAAAGANCNAACNCNANNANGGNCAGGTTCANCCNNNTTNCNTCTGAN GNAAAANNNNTNATTCNNCNCNNATTTNNNNNGTANCNTTNNNGNNANCAANNNNGNNNN NNNCNNNNNNNNNTCNNCATNNNNNNGCNNNNNTNNANNNNNNGNGNNNNNNNNNNNNNN ANNNNNNNNGNNACNNNNNNNNNANNNNNNNNNNNNNNNCNNGNANNNANNNNNNNNNNN
NNNNNNNGNN

99% max identity for pNic-Bsa4

pNic DNA Sequencing Results (pLic-FOR)

NNNNNNNNTNTNNNNNNNANNNNGANANNNNAGANNNCNCNNTNTTNNNTTNNTGTCTGGNGTTTACNNCNNNNTCTTGG
ANNNNNNNANNTCCCCCTCGGAGANTATANNNCTCTTATANTTGNNNNTCATAAAAATTCACNAGAAATTCCNTANNATG
ATTCNTAANNNANCNNGNNNAATTTGGCNANATTCTTTCNANGNTTCCNATTNAANNTTTAATTTTNANNNTTNCCNCCN
NNNANNNTTTTTNNTTTTCNTNNGGNCCGNCTNNNCCCNTTTNCCATNGAGGGGGTATCACCCTTCANANAAAAATACAA
CTACTGCNNACCCTTNANAATTTNANAGCTNGAGGNNNAAAANNTTTNTCNTNNNNNNGNNANNGATTCGTNNGTANGAN
NNCCNNNGTGNATANGGNNTNGTGNNNANNTNGNAGTCACCNCTTCNNTTTCNTNGCNTTCCCNTANNGTCCNNNACNNA
NTNGNCANNTGTAANNNNGAGGGATGGANNCNNNACACTNNNNTNNCTTTCTTTNTANNNGANANNNNANACANNNTCNT
CNAACANCNCGTAANNNAANTTANAGTACTTNCNTTCANTACNNCNNNGTTNGNCNGNNNNTCNNATNAAGNNTNCGACT
CANNCANNNNNNGATTGTCTTTAAATGANTCATCNNNNNNCNACCATNNTCNNTTCCCGTNTCANCNTTCACNNNTGNGT
TGNNTTGNCTGTTTTCTATGTTATCNTNCAGANTANACCTTNAACTACTTNACTTNNCNCCNTNTCTNGGCNCGCATTAT
NNANGTATTCACGATCNACNAANCTTNACATCNNANNNNNCANNNANNNNGGNCNNGNNNNNNCNTNGCNNNANCNGGAG
NNCTNNNNNGGNGANNANNGANNNNTTNNGGGGNANNNCGAANGNNCGGGAGGGANNNNGNNNGNCNNNNNNANNNGCNC
NCNGCAATAANCGGTCCCNNCCTGANGNGGGGGNTNNGNCNNNNGGNCCGGNNNNCNNAN

Overlap PCR for Tb6pgdh

Lane 1: 1kb DNA ladder
Lane 2: Primary PCR sample (made 7/6/13, used up and discarded)
Lane 3: Primary PCR sample (made 7/10/13 with oligo mix made 7/10/13)
Lane 4: Secondary PCR sample (made 7/8/13, but had a power outage in the PCR machine)
Lane 5: Secondary PCR sample (made 7/9/13 as a replacement for sample from Lane 4)

Secondary PCR Tb6pgdh

Primer overlap PCR of Tb6pgdh.
Lane 1: 1 kb DNA ladder
Lane 2: primary PCR sample
Lane 3: secondary PCR sample A
Lane 4: secondary PCR sample B

Summer 2013 WEEK 5-

Nanodrop of MidiPrep (pNic-Bsa4)



Nanodrop spectrometer result of pNic-Bsa4 MidiPrep.


Nanodrop spectrometer result of pNic-Bsa4 MidiPrep.

Overlap Primers PCR (Tb6pgdf, Option B)

VDS PMP and VLG Primer Overlap PCR
Lanes 1-3 are PMP's
Lane 4 is skipped
Lane 5: 1kb DNA ladder
Lane 6: primary PCR sample
Lane 7: secondary PCR sample

Overlap Primers PCR (Tb6pgdf, Option A)

VDS PMP and VLG PCR of overlap primers
Lanes 1-3 are PMP's
Lane 4 is skipped
Lane 5: 1 kb DNA ladder
Lane 6: Primary PCR sample
Lane 7: Secondary PCR sample

pLic PCR Agarose Gel (2)


VDS PMP and VLG pLic PCR gel result
Lane 1: 100 bp DNA ladder
Lane 2-5 are PMP's
Lane 6: 0.0305 ng/uL plasmid
Lane 7: 0.3 ng/uL plasmid
Lane 8: 3.1 ng/ul plasmid
Lane 9: no plasmid

PCR Primer Design

Target: 6-phosphogluconate dehydrogenase in Trypanosoma brucei

Gene: Tb927.9.12110
Forward Primer:UPSTREAM
5’ TAC TTC CAA TCC ATG TCT ATG GAC GTT GGT GT 3’ 32 bp
GC Content 43.8%
0 mM Mg2+ Tm 62.4 oC 1.5 mM Mg2+ Tm 69.7 oC 2 mM Mg2+ Tm 70.2 oC
4 mM Mg2+ Tm 71.3 oC 6 mM Mg2+ Tm 71.7 oC

Reverse Primer:DOWNSTREAM
5’ AGT GGC CGG AGC TGC AAT AAC AGT AAA GGT GGA TA 3’
Reverse complement it:
5’ TAT CCA CCT TTA CTG TTA TTG CAG CTC CGG CCA CT 3’ 35 bp
GC Content 48.6%
0 mM Mg2+ Tm 66.2 oC 1.5 mM Mg2+ Tm 73.3 oC 2 mM Mg2+ Tm 73.7 oC
4 mM Mg2+ Tm 74.6 oC 6 mM Mg2+ Tm 75.0 oC

Summer 2013 WEEK 4-

PfDXR Protein Characterization

VDS, PMP and VLG. PfDXR gel electrophoresis.
Lane 1: 100 bp DNA ladder
Lane 2: cell lysate before induction (sample 0)
Lane 3: cell lysate after induction
Lane 4: soluble fraction (Sample 2)
Lane 5: flow through (sample 3)
Lane 6: wash (sample 4)
Lane 7: elution 1 (sample 5)
Lane 8: elution 2 (sample 6)

RE Digest Results


VDS: PMP and VLG pGBR22
Lane 1: 1 kb DNA ladder
Lane 2: uncut pGBR22 plasmid
Lane 3: PvuII (PMP)
Lane 4: EcoRI-HF (PMP)
Lane 5: PvuII and EcoRI-HF (PMP)
Lane 6: PvuII (VLG)
Lane 7: EcoRI-HF (VLG)
Lane 8: PvuII and EcoRI-HF (VLG)
Lane 9: 1kb DNA ladder

PfDXR Nanodrop (Protein Purification)


Nanodrop spectrometer results of 2uL of Elution 1 of PfDXR.


Nanodrop spectrometer results of 2uL of Elution 2 of PfDXR.

pGFP DNA Sequencing Re-submission Results
Plasmid: pGFP Primer: T7

NNNNNNNNNNNNNNNNNNNANNNNNNTNGNGNNTTNGNNTCNGCNCGGGATGANANCTNGNTAGCGGNNAACCCNNNNNN
TNNNNNGNTCNNTNNNNNTNGNTNCNTGCGTANNNNNNTNTGNNANACNAAANGGATTAANTGAANNNNNNATNNNNNNC
NTAAAACGNANNNNNCNATTANANANTNANNANNGNNCTAAANTNCNNGNTGNCNNAATCNCTNGATTNNANGGTTAAAT
CCTGATAACCCNNNTANNNCNTGAATNNNNATNTTTCCTTACTNANGNACTTGCNGNNANNNNNTTANNNNTACN

BLAST comparison (nucleotide)
No similar sequences found

Plasmid: pGFP Primer: M13For-20

NNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNGNNNTANNGANTATNNTCNAGTGGAGTNGNNNCCCTCGNNCTNTNNNN
NNNTTCNCNATGGTNANTCCTCTNNNNGGGANNNNNNNCCANCTNNNNNNNNNNNNNNNNNGTNTNNNGTANNNNNNNAN
GCNTCNTGNNNNNTNNNTNGTNNTATNNNCNGNNTNNNNGTGNNANNGNNNGTTCNACTTNNNCCNNNTCTNGATNTCGN
AANTNNAGNNNNCNTCNTCNGGNNACNTCCNCTCNNNGNANGCTGCANAGCCCGTCNNCNNCTTCNGTNTTACNNNTNCG
TCNNAGGGGAAGTCTNNGCTNCNNNNNNTCANNNNGNNNATGANCTNNNCNTCCNGCNNNNANNANNCNNGNTNCNCTGT
CNNNNTNCCNNNNACCTNNATNTTCATNTCCCNCGNNNACNTNAATANTNNGGNNTNNNNNNCTTCAAAANNNNNGGATN
TNNNCGGTATGCGGNNCGTANNCNTNNNTGNCT

BLAST comparison (nucleotide)
No similar sequences found

Summer 2013 WEEK 3-

pmCHERRY PCR (1) Agarose Gel Results

PCR agarose gel result of pmCHERRY.
Lane 1: 100 bp DNA ladder
Lane 2: 0.02ng/uL pmCHERRY with VDSR
Lane 3: 0.2ng/uLpmCHERRY with VDSR primer
Lane 4: 2.0ng/uL pmCHERRY with VDSR primer
Lane 5: no DNA with VDSR primer
Lane 6: 0.02ng/ul pmCHERRY with M13 primer
Lane 7: 0.2ng/uL pmCHERRY with M13 primer
Lane 8: 2.0ng/uL pmCHERRY with M13 primer
Lane 9: no DNA with M13 primer

Nanodrop Results for pGFP DNA Sequencing Re-submission

Nanodrop spectrometer reading of 2 uL of pGFP.


Nanodrop spectrometer reading of 2 uL of pGFP.

Summer 2013 WEEK 2 -

Great work Vicky - glad you got the PCR to work! Did you get the DNA Sequence result yet? - Dr. B

PCR (3) Agarose Gel Results


VDS VLG 06-14-13 PCR of pGBR22
Lane 1: 100 bp DNA ladder
Lane 2: Sample A
Lane 2: Sample B
Lane 3: Sample C
Lane 4: Sample D

PCR (2) Agarose Gel Results

VDS PCR of pGBR22
Lanes 6-10(VLG).
Lane 6: 1kb DNA ladder
Lane 7: Sample A
Lane 8: Sample B
Lane 9: Sample C
Lane 10: Sample D

PCR (1) Agarose Gel Results

PCR of pGBR-22.
Lane 1: 100bp DNA ladder
Lane 2: Sample A
Lane 3: Sample B
Lane 4: Sample C
Lane 5: Sample D

MidiPrep DNA Sequencing
Plasmid: pNic-Bsa4 Primer: pLic-rev

NNNNNNNNNNNNNNNNNNNNNNNNNCTCNGTNNTGGTGGTGNTGGTGCTCGAGTGCGGCCGCAAGCTTGTCGACGGAGCT
CGAATTCGGATCCGTATCCACCTTTACTGTTAAGAGTTCAGCAGTGGACGACCCTGACCTTCCGCCAGTTTGATGAGTAC
GTCGAGTTGTTCGTCTTTCTGAACCATGATGCCATTACGCTGAACACGCATCTGAGAAACCATATCTTCGACAGACAGCT
GGCTGTTACGAGAATCGTTCATGCACATCGCACCGATCAGCTGCGCGGTACGACCTACACCGGCACGGCAGTGAATAACA
GGACGCAGTTTAGAGTCGTCCGCAACCGCAGAAGAACCTTTGCTTTCATACATGTTACGTTTAGTCTCCGCCGTTTGGTC
AACCAGAGACGCGAGGGCTTTCGTAACCTCGCTGCTAACTGCGGTCTGATCCGGCCAGTTACCAACGTGGACCACTGGGA
CGCTGATGGTTTTCTGACCGGCTTCACGGATGGTCAGCGTGTACATGTCCGCCATGATACCGTCACCCAGGCCAACTTGC
TGGGTCATCTTAGATTCAACGGTGATAGAGCCGTAGGTACCAGATTGACGAAAGTAGTCCGGCATACCAAAGCGCTGGTT
AGCGATTTCAGAGGAGGACGCCAGAACCGCGAGCACCGGGGTGCGGTTTTCGGCCAGCATACGGAAGTGAGACTCCAGTT
GAGATTGCAGCGGATACTGGCACGCGATGGTACGGGTGTTACCGACCTGGATATAGTTCGCGTTCAGGTCCGCGCGTACA
GCAGTCTGGCGACGACACTGGATGTCACGAAAACGGNTCAGTTTTTCACCACCGCACGCCTGGAGGTAACGCGGGTCGTT
GGTCGCCGGANCCAGGGTATTACGCANGGNGGTCAGACNAGANCTCANTTCCGCACGGGCTTCCGNACCGNATGGAGAAA
CGGTAGANNNAGCCGNNGCANNCGCCNCACCCGCACCGNGGNNGACCGCTGGNGNGAAGNNNNTCANNCANNNNTTGGAA
GNNCNNGTTCTCGGTTNCCCGNANNNNNCCNCCANAANNANNGATGANGANNNNGGNNNNNTNNNNNACNNNNNNNNNNA
AGTTNANNNNNNANTNNNTTNNNNNNGGGANNGNTNNCCCCCNNNNN

BLAST comparison (nucleotide)

MidiPrep Nanodrop

Nanodrop spectrophotometer reading of 2 ul of pNic-BSa4 at 230 nm.

Nanodrop spectrophotometer reading of 2 ul of pNic-BSa4 at 230 nm.

Summer 2013 WEEK 1

Transformation Plates

Figure 1: DH5-α bacteria colonies grown with 1 ng YopH + pNic plasmid in LB+Kan plate (Plate A)

Figure 2: DH5-α bacteria colonies grown with 5 ng YopH + pNic plasmid in LB+Kan plate (Plate B)

Figure 3: DH5-α bacteria colonies grown with 25 ng YopH + pNic plasmid in LB+Kan plate (Plate C)

Transformation Efficiency Calculations:
Plate A:
4 colonies/1ng plasmid = 4
Plate B:
0 colonies/5ng plasmid = 0
Plate C:
29 colonies/25ng plasmid = 1.16

DNA Sequencing
Plasmid: pGFP (green) Primer: T7

NNNNNNNNNNNNNNNNNNANNNNNNNNATTTNNTNGGGNANTTNNCAGTTTTAAAATTATNTTTTAAAATGGACTATCAT
ATNGCTTACCGTAACTTGAAAGTATTTCNATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCCATCAAT
GANATCANTGAAACTCNAGTTTCACTGATCTCATTGATGGTTTTTGAATTCTCNACCTCNANACAAATGGCANTATTCAT
CCNCAATTTTNAAANAAAAGGGGGGATTGGGGGGTACAGTGCANGGGAANNAATANTANACNTNATANCNNNNGANNTAN
N

BLAST comparison (pairwise nucleotide comparison)
No similar sequences were found when compared to A.victoria mRNA for green fluorescent protein (ID:gfp2).
Will be re-submitted.
Nanodrop

Nanodrop spectrophotometer measurement of 2 ul pGFP at 230 nm.

Nanodrop spectrophotometer measurement of 2 ul pGFP at 230 nm.